5G-modified-4,Tagged Alexaflour 488 at 3

Catalog #	Pkg Size	Price(USD)	Quantity	Buy this product
R-M2-11046	100nmol	1959.00	- +	+ Add to cart

Product description

5G-modified-4,Tagged Alexaflour 488 at 3(5G-modified-4,Tagged Alexaflour 488 at position 3) is a dual modified long G cluster highly stable functional fluorescent oligonucleotide probe with clear sequence and simultaneous 2- O-methylribose modification and thiophosphate backbone modification on the entire chain. It accurately labels Alexa Fluor 488 green fluorescent group at the 3 end through stable covalent coupling, and is currently the classic model probe with the closest modification degree to clinically marketed drugs in the development of antisense nucleic acid drugs.5G-modified-4,Tagged Alexaflour 488 at 3(5G-modified-4,Tagged Alexaflour 488 at position 3) is a dual modified long G cluster highly stable functional fluorescent oligonucleotide probe with clear sequence and simultaneous 2- O-methylribose modification and thiophosphate backbone modification on the entire chain. It accurately labels Alexa Fluor 488 green fluorescent group at the 3 end through stable covalent coupling, and is currently the classic model probe with the closest modification degree to clinically marketed drugs in the development of antisense nucleic acid drugs.

Appearance	N/A
Molecular Weight	N/A
Solubility	N/A
Molecular formula	N/A
Sequence	5GGGGGTGTAGCTCATAGCCG3-2-O-methyl phosphorothioate oligomers
Storage	-20℃, protected from light and moisture
Transportation	4-25℃ temperature for up to 1-3 weeks
Stability	6 months

Document