Home > Keywords > 
Catalog name Description price
R-M1-8488 FITC-adipic acid FITC-Adipic acid can be used in various research areas, such as studying metabolic processes, analyzing metabolic pathways, or investigating the metabolism of adipic acid in organisms or cells.FITC-Adipic acid is a useful tool for visualizing and detecting adipic acid in biological samples using fluorescence-based techniques. price>
R-C-6106 PI(4)P diC4 CAS:790192-01-7 D-myo-Phosphatidylinositol 4-phosphate,Dibutanoyl Phosphatidylinositol 4-phosphate, PtdIns(4)P C4, PI(4)P C4,or PI4P,Phosphatidylinositol 4-phosphate diC4 (PI(4)P diC4) is a synthetic, purified dibutanoyl PI(4)P.Phosphoinositides(PIPns)are minor components of cellular membranes but are integral signaling molecules for cellular communication.Phosphatidylinositol 4-phosphate(PI(4)P)is the biosynthetic precursor to PI(4,5)P2 and has an important roles in regulating sphingomyelin and glycosphingolipid metabolism and membrane trafficking at the exit of the Golgi complex. price>
R-M2-10123 C18-CpG-CY5 C18-CpG-CY5/C18-Thio DNA (CpG1018)-CY5 is a fluorescently labeled immunostimulant primarily used in vaccine adjuvant research and immune activation experiments. This product is only for scientific research and cannot be used on the human body. price>
R-M1-8489 DMG-PEG-R8 DMG-PEG-R8,DMG-PEG-octaarginine for enhanced delivery of a bioactive molecule into cells. The PEG2K component may contribute to improved stability and solubility, while the R8 component may aid in cellular uptake. price>
R-C-6107 PI(4)P diC8 CAS:214069-07-5 D-myo-Phosphatidylinositol 4-phosphate,Dioctanoyl Phosphatidylinositol 4-phosphate, PtdIns(4)P C8,PI(4)P C8, 8:0/8:0 PI(4)P,Phosphoinositides(PIPns)are minor components of cellular membranes but are integral signaling molecules for cellular communication.Phosphatidylinositol 4-phosphate(PI(4)P)is the biosynthetic precursor to PI(4,5)P2 and has an important roles in regulating sphingomyelin and glycosphingolipid metabolism and membrane trafficking at the exit of the Golgi complex. price>
R-M2-10124 E7(EPLQLKM)-peg-DMG E7(EPLQLKM)-peg-DMG/DMG-peg-E7(EPLQLKM)/-peg-DMG is an E7 derived peptide modified with PEG-DMG (di nutmeg glycerol polyethylene glycol), mainly used for targeted drug delivery and biological coupling research. Application: Targeted therapy: can be used in combination with chemotherapy drugs or siRNA for targeted therapy of HPV related tumors. Immune regulation: used in vaccine adjuvants or immunotherapy research, by activating the TLR pathway or regulating immune cell function. Biocoupling: As a connecting arm, it is used to construct peptide drug conjugates (PDCs) or nanocarriers. price>
R-M1-8490 DMG-PEG-RB DMG-PEG-RB,1,2-Dimyristoyl-sn-glycerol-methoxypolyethylene glycol-Rhodamine B from ruixibio.The combination of DMG, PEG, and RB in DMG-PEG-RB for specific applications such as enhanced cellular uptake or targeted delivery of a bioactive molecule. The PEG2000 component may contribute to improved solubility, while the RB component can enable fluorescence-based visualization or tracking of the delivered molecule. price>
R-C-6108 PI(5)P diC16 CAS:219527-75-8 D-myo-Phosphatidylinositol 5-phosphate,Dipalmitoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C16, PI(5)P C16,or PI5P,Phosphatidylinositol 5-phosphate diC16(PI(5)P diC16)is a synthetic,purified dipalmitoyl PI(5)P.Phosphoinositides(PIPns)are minor components of cellular membranes but are integral signaling molecules for cellular communication. price>
R-M2-10125 CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) is a type B CpG oligonucleotide with fluorescent labeling. Its core function is to activate the immune response through the TLR9 pathway, and it is commonly used in vaccine adjuvants and immunotherapy research. Application Scenario: Vaccine adjuvant: enhances antigen immunogenicity and reduces dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Analyze the TLR9 signaling pathway and immune cell activation mechanism. price>
R-M1-8491 CY5-PEG-iRGD CY5-PEG-iRGD is a compound designed for targeted delivery and imaging in cancer research. It consists of three components: CY5, a red fluorescent dye for visualization purposes; PEG, a biocompatible polymer that enhances stability and biocompatibility; and iRGD, a peptide sequence that specifically targets tumor cells. price>
R-C-6109 PI(5)P diC4 D-myo-Phosphatidylinositol 5-phosphate,Dibutanoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C4, PI(5)P C4,or PI5P,Phosphatidylinositol 5-phosphate diC4 (PI(5)P diC4)is a synthetic, purified dibutanoyl PI(5)P.Phosphoinositides(PIPns)are minor components of cellular membranes but are integral signaling molecules for cellular communication. price>
R-M2-10126 DMG-GPQGIAGQR-PEG-CpG-ODN DMG-GPQGIAGQR-PEG-CpG-ODN is a CpG oligonucleotide modified with PEG and DMG, mainly used in vaccine adjuvant and immunotherapy research. Application: Vaccine adjuvant: can enhance the immunogenicity of vaccines and reduce antigen dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Used to analyze the TLR9 signaling pathway and immune cell activation mechanism. price>
R-M1-8492 Tetracycline-OVA Tetracycline-OVA/OVA Conjugated Tetracycline (TTC)/Tetracycline [OVA] /Tetracycline (TTC) Protein (OVA)/Tetracycline protein (OVA) refers to the conjugation of Tetracycline with Ovalbumin (OVA). Tetracycline is a widely used antibiotic medication that belongs to the class of tetracycline antibiotics. Ovalbumin, on the other hand, is a protein found in egg whites and is commonly used as an antigen in immunological research. price>
R-C-6110 PI(5)P diC8 CAS:291527-92-9 Dioctanoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C8,PI(5)P C8, or PI5P,Dioctanoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C8,PI(5)P C8,or PI5P,Phosphoinositides (PIPns) are minor components of cellular membranes but are integral signaling molecules for cellular communication.Phosphatidylinositol 5-phosphate (PI(5)P) is a rare lipid found in the nucleus that can bind the PHD finger of the nuclear adapter protein ING2.PI(5)P is phosphorylated to PI(4,5)P2 by Type II PIP kinases. price>
R-M2-10127 Chol-GPQGIAGQR-PEG-CpG-ODN Chol-GPQIAGQR-PEG-CpG-ODN/Cholesterol-GPQGIAGQR-PEG-CpG-ODN is a CpG oligonucleotide modified with cholesterol (Chol), GPQGIAGQR peptide, and PEG2000, mainly used in vaccine adjuvant and immunotherapy research. Application: Vaccine adjuvant: can enhance the immunogenicity of vaccines and reduce antigen dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Used to analyze the TLR9 signaling pathway and immune cell activation mechanism. price>
R-M2-10128 CpG@GNPs CpG oligonucleotide(CpG-ODN) modified gold nanoparticles (GNPs) are a promising material for immunotherapy and vaccine adjuvants. Application scenarios: Vaccine adjuvant: can enhance the immunogenicity of vaccines and reduce antigen dosage. Immunotherapy: It is used to treat cancer and infectious diseases, inhibit tumors or eliminate pathogens by activating the immune system. Biosensing: Utilizing the optical properties of gold nanoparticles to construct a highly sensitive and selective nano biosensing platform. Notes: Dispersion method of solid dry powder: Take an appropriate amount of solid dry powder as needed, add pure water until the freeze-dried powder is completely dissolved, and use water bath ultrasound for 5-30 seconds to promote the dispersion of nanomaterials. If the dispersion is not complete, the water bath ultrasound time can be extended to 2 minutes. If physiological saline or buffer solution is needed for dispersion, please add an equal volume of 2 x physiological saline or buffer solution to make the final concentration of physiological saline or buffer solution 1 x normal concentration. price>
R-M1-8493 FITC-DITWDQLWDLMK E-selectin binding peptide (Esbp, primary sequence DITWDQLWDLMK),FITC labelled /FITC-DITWDQLWDLMKcan be used for selectively target drug delivery systems to tumor vasculature research. Among,E-selectin binding peptide (Esbp, primary sequence DITWDQLWDLMK) as targeting ligand.The conjugation of FITC with the peptide sequence DITWDQLWDLMK allows for the visualization and tracking of the peptide using fluorescence microscopy or other fluorescence-based techniques. This compound can be used in various research applications, such as cellular imaging, protein localization studies, or receptor-ligand interaction studies. price>
R-C-6111 PLPC (16:0/18:2 PC) CAS:17708-90-6 1-Palmitoyl-2-linoleoyl-sn-glycero-3-phosphocholine(PLPC) is a phosphocholine with palmitic(16:0)and linoleic(18:2) acids acyl chains.Phosphatidylcholine(PC)is generally the most abundant lipid in animal cell membranes providing structural framework. price>
R-M1-8494 TTQ-F-PSar water-soluble TTQ-F-PSar water-soluble/TTQ-F(tetraaminoquinoline-fluorophore)-PSar(proline-substituted sarcosine) water-soluble is a compound that consists of two main components: TTQ-F and PSar. TTQ-F: TTQ-F refers to tetraaminoquinoline-fluorophore, which is a fluorescent molecule containing a quinoline core. It is often used as a fluorescent probe in various biological and chemical applications. PSar: PSar stands for proline-substituted sarcosine, which is a modified amino acid. Sarcosine is a derivative of the natural amino acid glycine. TTQ-F-PSar could serve as a fluorescence probe for targeting specific molecules or for studying cellular processes. price>
R-C-6112 PLPEth (16:0/18:2 PEth) CAS:336786-73-3 1-Palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanol(PLPEth)is a form of phosphatidylethanol(PEth), which is formed primarily by transphosphatidylation of phosphatidylcholine(PC)by phospholipase D. Most PEth(about 75%)is incorporated into erythrocyte membranes,and is one of the longest-lived circulating EtOH metabolite yet identified. price>