Xi'an ruixi Biological Technology Co

Home > Keywords >

Catalog	name	Description	price
R-M2-10129	RhB labeled mPEG-b-PCGE loaded resveratrol	RhB labeled mPEG-b-PCGE loaded resveratrol is a nanocarrier that combines fluorescence tracing and drug delivery functions, mainly used for the delivery and distribution research of resveratrol. Rhodamine B serves as a fluorescent probe for real-time tracking of carrier distribution and drug release in vivo.	price>
R-M1-8495	Fitc-β-Ergosterol	The conjugation of FITC with β-Ergosterol allows for the visualization and tracking of β-Ergosterol in biological systems using fluorescence microscopy or other fluorescence-based techniques. This compound may be used to investigate the distribution, localization, and metabolism of β-Ergosterol in cells or tissues.	price>
R-C-6113	POPEth CAS：765260-45-5	1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanol(POPEth)is a form of phosphatidylethanol(PEth), which is formed primarily by transphosphatidylation of phosphatidylcholine(PC)by phospholipase D. Most PEth(about 75%)is incorporated into erythrocyte membranes,and is one of the longest-lived circulating EtOH metabolite yet identified.	price>
R-M2-10130	E7(EPLQLKM)-peg-Chol	E7 (EPLQLKM)-peg-Chol/E7(EPLQLKM)-peg-Cholesterol/Cholesterol-peg-E7(EPLQLKM) is an E7 derived peptide modified with PEG and cholesterol (Chol), mainly used for targeted drug delivery and biological coupling research. Application: Targeted therapy: Can be coupled with chemotherapy drugs or siRNA for targeted therapy of HPV related tumors. Immune regulation: used in vaccine adjuvant or immunotherapy research by activating the TLR pathway or regulating immune cell function. Biocoupling: As a connecting arm, it is used to construct peptide drug conjugates (PDCs) or nanocarriers.	price>
R-M1-8496	mpeg2000-SFSHHTPILPLCK	MPEG2000-SFSHHTPILPLCK is a peptide sequence composed of specific amino acids.	price>
R-C-6114	PtdIns(4,5)P2 a-fluorovinylphosphate diC8	PtdIns(4,5)P2 a-fluorovinylphosphate diC8 is a water soluble, synthetic PI(4,5)P2 analog in which the phosphodiester bond has been rendered metabolically stable via the α-fluorovinylphosphonate.	price>
R-M2-10131	/5/TCGTCGTTTTGTCGTTTTGTCGTT*/3/Cholesteryl/	/5 /* T * C * G * T * G * T * T * T * G * T * G * T * T * T * G * T * T * G * T * T * 3/Cholesteryl/;TCGTCGTTTTGTCGTTTGTCGTT-Cholesteryl is also a cholesterol modified oligonucleotide, mainly used for drug delivery and biological coupling research.	price>
R-M1-8497	RGD-alginate	RGD-alginate/RGD-peptide modified alginate/arginine-glycine-aspartate (RGD)-peptide-coupled alginates is a biomaterial consisting of alginate, a polysaccharide derived from seaweed, that has been modified with the RGD peptide sequence. RGD-alginate is commonly used in biomedical applications, particularly in tissue engineering and regenerative medicine.The RGD peptide sequence (Arg-Gly-Asp) is known for its ability to specifically bind to integrin receptors on cell surfaces. Integrins are cell surface proteins that play a critical role in cell adhesion, migration, and signaling. Integrin binding to the RGD sequence promotes cell attachment and interaction with the biomaterial.	price>
R-C-6115	S-lysoPC-d9 (18:0 LPC-d9)	LysoPC is generated through hydrolysis of the sn-2 acyl chain of PC by phospholipase A2.LysoPC is the substrate for Autotaxin/LysoPLD generating lysophosphatidic acid which has an important role in cell motility.This analog is deuterated on the choline headgroup.	price>
R-M2-10132	Cy5-TCGTCGTTTTGTCGTTTTGTCGT*T-Cholesteryl	Cy5-TCGTCGTTTTGTCGTTTTGTCGT*T-Cholesteryl is a CpG oligonucleotide with a CY5 fluorescent group labeled at the 5 end and cholesterol linked at the 3 end, mainly used in vaccine adjuvants and immunotherapy research.	price>
R-M1-8498	mPEG20K-BSA	mPEG20K-BSA refers to a conjugate of Bovine Serum Albumin (BSA) and mPEG20K, which stands for methoxy polyethylene glycol with a molecular weight of 20,000. BSA is a protein commonly derived from the blood of cows and is widely used in biochemical research, diagnostics, and various other applications. It has a range of uses in areas such as enzyme assays, cell culture, and protein standards.	price>
R-C-6116	S-lysoPC, (18:0 LPC) CAS：19420-57-6	1-Stearoyl-2-hydroxy-sn-glycero-3-phosphocholine (S-lysoPC,LPC) is generated through hydrolysis of the sn-2 acyl chain of PC by phospholipase A2.It is a major component of oxidized low-density lipoprotein and is believed to have an important role in inflammatory diseases and atherosclerosis.	price>
R-M2-10133	mPEG-TK-ICG	MPEG-TK-ICG/Polyethylene glycol-thioketal-indocyanine green is a complex with near-infrared fluorescence and photothermal conversion ability. It is mainly used for biomedical imaging and photothermal therapy.	price>
R-M1-8499	RhB-Binimetinib	By conjugating Binimetinib with Rhodamine B, the resulting RhB-Binimetinib conjugate can serve as a tool to visualize or track the intracellular distribution and localization of Binimetinib in cells or tissues. This conjugation allows for the monitoring of drug uptake, distribution, and retention within biological systems.	price>
R-C-6117	S1P Fluorescein	Sphingosine 1-phosphate(S1P)is a bioactive lysophospholipid formed by phosphorylation of sphingosine by sphingosine kinases.S1P binds to five G-protein coupled receptors designated S1P1-5 leading to cell proliferation,motility,and has a role in regulation cell shape.In addition,S1P acts as an intracellular mediator in a receptor-independent manner regulating cell survival and Ca2+ homeostasis.	price>
R-M2-10134	GA@PEG-TK-ICG PMs	Gambogic acid@Polyethylene Glycol thioketal Indocyanine green polymeric micelles are a cutting-edge therapeutic nanomedicine delivery system. Polyethylene glycol thioketal (PEG thioketal): an oxidation-reduction responsive polymer whose thioketal (TK) bond specifically breaks under high glutathione (GSH) conditions in the tumor microenvironment, achieving precise drug release and reducing normal tissue toxicity. Indocyanine green (ICG):a near-infrared fluorescent dye (absorption peak~780 nm, emission peak~810 nm) that combines tumor imaging capability with photothermal conversion efficiency (PTT). It can achieve "chemotherapy photothermal" combination therapy in synergy with oxalic acid.	price>
R-M1-8500	Cy5.5-Enterodiol	Cy5.5-Enterodiol conjugate can be utilized as a molecular probe for studying the uptake, metabolism, and distribution of Enterodiol in biological systems. The fluorescent properties of Cy5.5 allow for visualizing and tracking the localization of Enterodiol within cells or tissues, providing valuable insights into its biological activities and potential therapeutic applications.	price>
R-C-6118	S1P Lyase Fluorogenic Substrate CAS：1166838-84-1	S1P Lyase Fluorogenic Substrate is designed for monitoring S1PL activity by releasing fluorescent 7-hydroxycoumarin in the presence of active enzyme.Sphingosine-1-phosphate lyase(S1PL)cleaves sphingosine-1-phosphate into hexadecenal and phosphoethanolamine.	price>
R-M2-10135	Alkyne-A-DSBSO crosslinker	Alkyne-A-DSBSO crosslinking agent (CAS: 1704097-05-1) is a high-purity alkynyl click chemical crosslinking reagent, mainly used for biological molecular labeling and protein interaction research, suitable for scientific research fields.	price>
R-M1-8501	Cy5-Tacrolimus	Cy5-Tacrolimus conjugate can serve as a tool for studying the distribution, localization, and uptake of Tacrolimus within cells or tissues. It allows for the visualization and tracking of the drug presence and accumulation, providing valuable insights into its pharmacokinetics and biodistribution in biological systems.	price>

112511261127112811291130 11311132113311341135