Home > Keywords >
| Catalog | name | Description | price |
|---|---|---|---|
| R-C-6108 | PI(5)P diC16 CAS:219527-75-8 | D-myo-Phosphatidylinositol 5-phosphate,Dipalmitoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C16, PI(5)P C16,or PI5P,Phosphatidylinositol 5-phosphate diC16(PI(5)P diC16)is a synthetic,purified dipalmitoyl PI(5)P.Phosphoinositides(PIPns)are minor components of cellular membranes but are integral signaling molecules for cellular communication. | price> |
| R-M2-10125 | CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) | CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) is a type B CpG oligonucleotide with fluorescent labeling. Its core function is to activate the immune response through the TLR9 pathway, and it is commonly used in vaccine adjuvants and immunotherapy research. Application Scenario: Vaccine adjuvant: enhances antigen immunogenicity and reduces dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Analyze the TLR9 signaling pathway and immune cell activation mechanism. | price> |
| R-M1-8491 | CY5-PEG-iRGD | CY5-PEG-iRGD is a compound designed for targeted delivery and imaging in cancer research. It consists of three components: CY5, a red fluorescent dye for visualization purposes; PEG, a biocompatible polymer that enhances stability and biocompatibility; and iRGD, a peptide sequence that specifically targets tumor cells. | price> |
| R-C-6109 | PI(5)P diC4 | D-myo-Phosphatidylinositol 5-phosphate,Dibutanoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C4, PI(5)P C4,or PI5P,Phosphatidylinositol 5-phosphate diC4 (PI(5)P diC4)is a synthetic, purified dibutanoyl PI(5)P.Phosphoinositides(PIPns)are minor components of cellular membranes but are integral signaling molecules for cellular communication. | price> |
| R-M2-10126 | DMG-GPQGIAGQR-PEG-CpG-ODN | DMG-GPQGIAGQR-PEG-CpG-ODN is a CpG oligonucleotide modified with PEG and DMG, mainly used in vaccine adjuvant and immunotherapy research. Application: Vaccine adjuvant: can enhance the immunogenicity of vaccines and reduce antigen dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Used to analyze the TLR9 signaling pathway and immune cell activation mechanism. | price> |
| R-M1-8492 | Tetracycline-OVA | Tetracycline-OVA/OVA Conjugated Tetracycline (TTC)/Tetracycline [OVA] /Tetracycline (TTC) Protein (OVA)/Tetracycline protein (OVA) refers to the conjugation of Tetracycline with Ovalbumin (OVA). Tetracycline is a widely used antibiotic medication that belongs to the class of tetracycline antibiotics. Ovalbumin, on the other hand, is a protein found in egg whites and is commonly used as an antigen in immunological research. | price> |
| R-C-6110 | PI(5)P diC8 CAS:291527-92-9 | Dioctanoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C8,PI(5)P C8, or PI5P,Dioctanoyl Phosphatidylinositol 5-phosphate,PtdIns(5)P C8,PI(5)P C8,or PI5P,Phosphoinositides (PIPns) are minor components of cellular membranes but are integral signaling molecules for cellular communication.Phosphatidylinositol 5-phosphate (PI(5)P) is a rare lipid found in the nucleus that can bind the PHD finger of the nuclear adapter protein ING2.PI(5)P is phosphorylated to PI(4,5)P2 by Type II PIP kinases. | price> |
| R-M2-10127 | Chol-GPQGIAGQR-PEG-CpG-ODN | Chol-GPQIAGQR-PEG-CpG-ODN/Cholesterol-GPQGIAGQR-PEG-CpG-ODN is a CpG oligonucleotide modified with cholesterol (Chol), GPQGIAGQR peptide, and PEG2000, mainly used in vaccine adjuvant and immunotherapy research. Application: Vaccine adjuvant: can enhance the immunogenicity of vaccines and reduce antigen dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Used to analyze the TLR9 signaling pathway and immune cell activation mechanism. | price> |
| R-M2-10128 | CpG@GNPs | CpG oligonucleotide(CpG-ODN) modified gold nanoparticles (GNPs) are a promising material for immunotherapy and vaccine adjuvants. Application scenarios: Vaccine adjuvant: can enhance the immunogenicity of vaccines and reduce antigen dosage. Immunotherapy: It is used to treat cancer and infectious diseases, inhibit tumors or eliminate pathogens by activating the immune system. Biosensing: Utilizing the optical properties of gold nanoparticles to construct a highly sensitive and selective nano biosensing platform. Notes: Dispersion method of solid dry powder: Take an appropriate amount of solid dry powder as needed, add pure water until the freeze-dried powder is completely dissolved, and use water bath ultrasound for 5-30 seconds to promote the dispersion of nanomaterials. If the dispersion is not complete, the water bath ultrasound time can be extended to 2 minutes. If physiological saline or buffer solution is needed for dispersion, please add an equal volume of 2 x physiological saline or buffer solution to make the final concentration of physiological saline or buffer solution 1 x normal concentration. | price> |
| R-M1-8493 | FITC-DITWDQLWDLMK | E-selectin binding peptide (Esbp, primary sequence DITWDQLWDLMK),FITC labelled /FITC-DITWDQLWDLMKcan be used for selectively target drug delivery systems to tumor vasculature research. Among,E-selectin binding peptide (Esbp, primary sequence DITWDQLWDLMK) as targeting ligand.The conjugation of FITC with the peptide sequence DITWDQLWDLMK allows for the visualization and tracking of the peptide using fluorescence microscopy or other fluorescence-based techniques. This compound can be used in various research applications, such as cellular imaging, protein localization studies, or receptor-ligand interaction studies. | price> |
| R-C-6111 | PLPC (16:0/18:2 PC) CAS:17708-90-6 | PLinPC,1-Palmitoyl-2-linoleoyl-sn-glycero-3-phosphocholine(PLPC) is a phosphocholine with palmitic(16:0)and linoleic(18:2) acids acyl chains.Phosphatidylcholine(PC)is generally the most abundant lipid in animal cell membranes providing structural framework. | price> |
| R-M1-8494 | TTQ-F-PSar water-soluble | TTQ-F-PSar water-soluble/TTQ-F(tetraaminoquinoline-fluorophore)-PSar(proline-substituted sarcosine) water-soluble is a compound that consists of two main components: TTQ-F and PSar. TTQ-F: TTQ-F refers to tetraaminoquinoline-fluorophore, which is a fluorescent molecule containing a quinoline core. It is often used as a fluorescent probe in various biological and chemical applications. PSar: PSar stands for proline-substituted sarcosine, which is a modified amino acid. Sarcosine is a derivative of the natural amino acid glycine. TTQ-F-PSar could serve as a fluorescence probe for targeting specific molecules or for studying cellular processes. | price> |
| R-C-6112 | PLPEth (16:0/18:2 PEth) CAS:336786-73-3 | 1-Palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanol(PLPEth)is a form of phosphatidylethanol(PEth), which is formed primarily by transphosphatidylation of phosphatidylcholine(PC)by phospholipase D. Most PEth(about 75%)is incorporated into erythrocyte membranes,and is one of the longest-lived circulating EtOH metabolite yet identified. | price> |
| R-M2-10129 | RhB labeled mPEG-b-PCGE loaded resveratrol | RhB labeled mPEG-b-PCGE loaded resveratrol is a nanocarrier that combines fluorescence tracing and drug delivery functions, mainly used for the delivery and distribution research of resveratrol. Rhodamine B serves as a fluorescent probe for real-time tracking of carrier distribution and drug release in vivo. | price> |
| R-M1-8495 | Fitc-β-Ergosterol | The conjugation of FITC with β-Ergosterol allows for the visualization and tracking of β-Ergosterol in biological systems using fluorescence microscopy or other fluorescence-based techniques. This compound may be used to investigate the distribution, localization, and metabolism of β-Ergosterol in cells or tissues. | price> |
| R-C-6113 | POPEth CAS:765260-45-5 | 1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanol(POPEth)is a form of phosphatidylethanol(PEth), which is formed primarily by transphosphatidylation of phosphatidylcholine(PC)by phospholipase D. Most PEth(about 75%)is incorporated into erythrocyte membranes,and is one of the longest-lived circulating EtOH metabolite yet identified. | price> |
| R-M2-10130 | E7(EPLQLKM)-peg-Chol | E7 (EPLQLKM)-peg-Chol/E7(EPLQLKM)-peg-Cholesterol/Cholesterol-peg-E7(EPLQLKM) is an E7 derived peptide modified with PEG and cholesterol (Chol), mainly used for targeted drug delivery and biological coupling research. Application: Targeted therapy: Can be coupled with chemotherapy drugs or siRNA for targeted therapy of HPV related tumors. Immune regulation: used in vaccine adjuvant or immunotherapy research by activating the TLR pathway or regulating immune cell function. Biocoupling: As a connecting arm, it is used to construct peptide drug conjugates (PDCs) or nanocarriers. | price> |
| R-M1-8496 | mpeg2000-SFSHHTPILPLCK | MPEG2000-SFSHHTPILPLCK is a peptide sequence composed of specific amino acids. | price> |
| R-C-6114 | PtdIns(4,5)P2 a-fluorovinylphosphate diC8 | PtdIns(4,5)P2 a-fluorovinylphosphate diC8 is a water soluble, synthetic PI(4,5)P2 analog in which the phosphodiester bond has been rendered metabolically stable via the α-fluorovinylphosphonate. | price> |
| R-M2-10131 | /5/*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T*/3/Cholesteryl/ | /5 /* T * C * G * T * G * T * T * T * G * T * G * T * T * T * G * T * T * G * T * T * 3/Cholesteryl/;TCGTCGTTTTGTCGTTTGTCGTT-Cholesteryl is also a cholesterol modified oligonucleotide, mainly used for drug delivery and biological coupling research. | price> |

Items-$0.00

Email:
Tel.:
RuixiBiotechCo.Ltd /KamulinBiotechco.ltd
Add: Room 20F 2002, Meiyuan Building, Yanta District, Xi’ an City, Shaanxi Province 710061 China
Tel: 02988811435
Fax: (86-29)8881-1435
Email: sales@ruixibiotech.com
Web: http://www.ruixibiotech.com


