Xi'an ruixi Biological Technology Co

Home > Keywords >

Catalog	name	Description	price
R-M1-8493	FITC-DITWDQLWDLMK	E-selectin binding peptide (Esbp, primary sequence DITWDQLWDLMK),FITC labelled /FITC-DITWDQLWDLMKcan be used for selectively target drug delivery systems to tumor vasculature research. Among,E-selectin binding peptide (Esbp, primary sequence DITWDQLWDLMK) as targeting ligand.The conjugation of FITC with the peptide sequence DITWDQLWDLMK allows for the visualization and tracking of the peptide using fluorescence microscopy or other fluorescence-based techniques. This compound can be used in various research applications, such as cellular imaging, protein localization studies, or receptor-ligand interaction studies.	price>
R-C-6111	PLPC (16:0/18:2 PC) CAS:17708-90-6	PLinPC,1-Palmitoyl-2-linoleoyl-sn-glycero-3-phosphocholine(PLPC) is a phosphocholine with palmitic(16:0)and linoleic(18:2) acids acyl chains.Phosphatidylcholine(PC)is generally the most abundant lipid in animal cell membranes providing structural framework.	price>
R-C-7691	DSPE-PEG-CHA-ARY-CHA-ARY-CHA-ARY-NH2	This product consists of four parts:DSPE hydrophobic anchoring segment,PEG hydrophilic spacer chain, three-stage repeating CHA-ARY-CHA-ARY-CHA-ARY-CHA-ARY functional unit,and terminal active amino group.It can be directly used for surface modification of liposomes.Three repeated CHA-ARY units can achieve multivalent synergistic effects,significantly enhancing target binding affinity while retaining the fundamental properties of DSPE-PEG,such as long cycling and non-specific adsorption resistance.This product is only for scientific research and cannot be used on the human body.	price>
R-M1-8494	TTQ-F-PSar water-soluble	TTQ-F-PSar water-soluble/TTQ-F(tetraaminoquinoline-fluorophore)-PSar(proline-substituted sarcosine) water-soluble is a compound that consists of two main components: TTQ-F and PSar. TTQ-F: TTQ-F refers to tetraaminoquinoline-fluorophore, which is a fluorescent molecule containing a quinoline core. It is often used as a fluorescent probe in various biological and chemical applications. PSar: PSar stands for proline-substituted sarcosine, which is a modified amino acid. Sarcosine is a derivative of the natural amino acid glycine. TTQ-F-PSar could serve as a fluorescence probe for targeting specific molecules or for studying cellular processes.	price>
R-C-6112	PLPEth (16:0/18:2 PEth) CAS：336786-73-3	1-Palmitoyl-2-linoleoyl-sn-glycero-3-phosphoethanol(PLPEth)is a form of phosphatidylethanol(PEth), which is formed primarily by transphosphatidylation of phosphatidylcholine(PC)by phospholipase D. Most PEth(about 75%)is incorporated into erythrocyte membranes,and is one of the longest-lived circulating EtOH metabolite yet identified.	price>
R-M2-10129	RhB labeled mPEG-b-PCGE loaded resveratrol	RhB labeled mPEG-b-PCGE loaded resveratrol is a nanocarrier that combines fluorescence tracing and drug delivery functions, mainly used for the delivery and distribution research of resveratrol. Rhodamine B serves as a fluorescent probe for real-time tracking of carrier distribution and drug release in vivo.	price>
R-C-7692	DSPE-SS-PEG-CY5	DSPE-SS-PEG-CY5 is a functionalized molecule based on a phospholipid skeleton, whose structure is composed of multiple functional modules connected in an orderly manner.The core component is distearoyl phosphatidylethanolamine(DSPE),which has good amphiphilicity and can spontaneously form stable micelles or embed into lipid bilayer structures in aqueous environments.By connecting polyethylene glycol(PEG)chains through reducible disulfide bonds (SS),the molecule is endowed with environmental responsiveness,particularly allowing for structural dissociation under reducing conditions.The PEG chain end is modified with CY5 fluorescent dye,giving it near-infrared optical signal output capability.This product is only for scientific research and cannot be used on the human body.	price>
R-M1-8495	Fitc-β-Ergosterol	The conjugation of FITC with β-Ergosterol allows for the visualization and tracking of β-Ergosterol in biological systems using fluorescence microscopy or other fluorescence-based techniques. This compound may be used to investigate the distribution, localization, and metabolism of β-Ergosterol in cells or tissues.	price>
R-C-6113	POPEth CAS：765260-45-5	1-Palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanol(POPEth)is a form of phosphatidylethanol(PEth), which is formed primarily by transphosphatidylation of phosphatidylcholine(PC)by phospholipase D. Most PEth(about 75%)is incorporated into erythrocyte membranes,and is one of the longest-lived circulating EtOH metabolite yet identified.	price>
R-M2-10130	E7(EPLQLKM)-peg-Chol	E7 (EPLQLKM)-peg-Chol/E7(EPLQLKM)-peg-Cholesterol/Cholesterol-peg-E7(EPLQLKM) is an E7 derived peptide modified with PEG and cholesterol (Chol), mainly used for targeted drug delivery and biological coupling research. Application: Targeted therapy: Can be coupled with chemotherapy drugs or siRNA for targeted therapy of HPV related tumors. Immune regulation: used in vaccine adjuvant or immunotherapy research by activating the TLR pathway or regulating immune cell function. Biocoupling: As a connecting arm, it is used to construct peptide drug conjugates (PDCs) or nanocarriers.	price>
R-C-7693	PBAE-PEG-iRGD	iRGD-PEG-PBAE,Poly (b- amino ester)-polyethylene glycol iRGD(PBAE PEG iRGD)is a multifunctional biomedical material that combines degradable cationic polymers,biocompatible segments, and tumor targeting active peptides.The iRGD segment tumor penetrating peptide can specifically recognize the αvβ3/5 integrin and neuropilin-1 receptor on the surface of tumor tissue,greatly enhancing the tumor targeted enrichment and deep penetration ability of the carrier.This product is only for scientific research and cannot be used on the human body.	price>
R-M1-8496	mpeg2000-SFSHHTPILPLCK	MPEG2000-SFSHHTPILPLCK is a peptide sequence composed of specific amino acids.	price>
R-C-6114	PtdIns(4,5)P2 a-fluorovinylphosphate diC8	PtdIns(4,5)P2 a-fluorovinylphosphate diC8 is a water soluble, synthetic PI(4,5)P2 analog in which the phosphodiester bond has been rendered metabolically stable via the α-fluorovinylphosphonate.	price>
R-M2-10131	/5/TCGTCGTTTTGTCGTTTTGTCGTT*/3/Cholesteryl/	/5 /* T * C * G * T * G * T * T * T * G * T * G * T * T * T * G * T * T * G * T * T * 3/Cholesteryl/;TCGTCGTTTTGTCGTTTGTCGTT-Cholesteryl is also a cholesterol modified oligonucleotide, mainly used for drug delivery and biological coupling research.	price>
R-C-7694	DSPE-PEG-MLSLRQSIRFFKC	MLSLRQSIRFFKC-PEG-DSPE,DSPE hydrophobic anchoring segment,PEG hydrophilic spacer chain,MLSLRQSIRFFKC a mitochondrial targeting peptide composed of 13 amino acids (Met-Leu-Ser-Leu-Arg-Gln-Ser-Ile-Arg-Phe-Phe-Lys-Cys),which can specifically recognize TOM complexes on the outer membrane of mitochondria and mediate vector entry into mitochondria.This product is only for scientific research and cannot be used on the human body.	price>
R-M1-8497	RGD-alginate	RGD-alginate/RGD-peptide modified alginate/arginine-glycine-aspartate (RGD)-peptide-coupled alginates is a biomaterial consisting of alginate, a polysaccharide derived from seaweed, that has been modified with the RGD peptide sequence. RGD-alginate is commonly used in biomedical applications, particularly in tissue engineering and regenerative medicine.The RGD peptide sequence (Arg-Gly-Asp) is known for its ability to specifically bind to integrin receptors on cell surfaces. Integrins are cell surface proteins that play a critical role in cell adhesion, migration, and signaling. Integrin binding to the RGD sequence promotes cell attachment and interaction with the biomaterial.	price>
R-C-6115	S-lysoPC-d9 (18:0 LPC-d9)	LysoPC is generated through hydrolysis of the sn-2 acyl chain of PC by phospholipase A2.LysoPC is the substrate for Autotaxin/LysoPLD generating lysophosphatidic acid which has an important role in cell motility.This analog is deuterated on the choline headgroup.	price>
R-M2-10132	Cy5-TCGTCGTTTTGTCGTTTTGTCGT*T-Cholesteryl	Cy5-TCGTCGTTTTGTCGTTTTGTCGT*T-Cholesteryl is a CpG oligonucleotide with a CY5 fluorescent group labeled at the 5 end and cholesterol linked at the 3 end, mainly used in vaccine adjuvants and immunotherapy research.	price>
R-C-7695	DSPE-PEG-CRLTAAGGLK(RB)	CRLTAAGGLK(RB)-PEG-DSPE,DSPE-PEG-CRLTAAGGLK(RB)is a functionalized phospholipid derivative primarily used for active targeted modification and tracking of nanomedicines. Amphiphilic self-assembly:It has excellent amphiphilicity and is easily soluble in organic solvents such as chloroform and DMSO.It can be stably dispersed in aqueous phase and inserted into lipid membranes. Dual functions of targeting and tracing:it achieves active targeted enrichment of specific cells/tissues through peptide sequences,and uses RB fluorescence signals to monitor carrier distribution in real-time.This product is only for scientific research and cannot be used on the human body.	price>
R-M1-8498	mPEG20K-BSA	mPEG20K-BSA refers to a conjugate of Bovine Serum Albumin (BSA) and mPEG20K, which stands for methoxy polyethylene glycol with a molecular weight of 20,000. BSA is a protein commonly derived from the blood of cows and is widely used in biochemical research, diagnostics, and various other applications. It has a range of uses in areas such as enzyme assays, cell culture, and protein standards.	price>

115011511152115311541155 11561157115811591160