Catalog name Description price
R-M2-10123 C18-CpG-CY5 C18-CpG-CY5/C18-Thio DNA (CpG1018)-CY5 is a fluorescently labeled immunostimulant primarily used in vaccine adjuvant research and immune activation experiments. This product is only for scientific research and cannot be used on the human body. price>
R-M2-10125 CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) CY5-CpG(TCGAACGTTCGAACGTTCGAACGTTCGAAT) is a type B CpG oligonucleotide with fluorescent labeling. Its core function is to activate the immune response through the TLR9 pathway, and it is commonly used in vaccine adjuvants and immunotherapy research. Application Scenario: Vaccine adjuvant: enhances antigen immunogenicity and reduces dosage. Immunotherapy: Used in combination with chemotherapy and radiotherapy to improve the tumor microenvironment. Mechanism research: Analyze the TLR9 signaling pathway and immune cell activation mechanism. price>
R-M1-8500 Cy5.5-Enterodiol Cy5.5-Enterodiol conjugate can be utilized as a molecular probe for studying the uptake, metabolism, and distribution of Enterodiol in biological systems. The fluorescent properties of Cy5.5 allow for visualizing and tracking the localization of Enterodiol within cells or tissues, providing valuable insights into its biological activities and potential therapeutic applications. price>
R-M1-8501 Cy5-Tacrolimus Cy5-Tacrolimus conjugate can serve as a tool for studying the distribution, localization, and uptake of Tacrolimus within cells or tissues. It allows for the visualization and tracking of the drug presence and accumulation, providing valuable insights into its pharmacokinetics and biodistribution in biological systems. price>
R-M1-8504 Cy2-Agarose Cy2-Agarose refers to a conjugate of the fluorescent dye Cy2 and agarose, a polysaccharide derived from seaweed commonly used in molecular biology applications as a gel matrix. price>
R-M1-8505 Cy2-sucrose Cy2-sucrose is a fluorescent dye-conjugated derivative of sucrose. Cy2-sucrose is a useful tool for visualizing and studying the behavior and distribution of sucrose in biological samples. price>
R-M2-10143 Cyanine5.5-peg-Doxorubicin HCL Cyanine5.5-PEG-Doxorubicin HCl is a fluorescent labeled complex in which Doxorubicin is linked to the anthocyanin dye Cyanine5.5 (Cy5.5) via polyethylene glycol (PEG). It is commonly used in drug delivery and imaging research in the scientific field. This compound combines the anti-tumor activity of chemotherapy drug doxorubicin, the biocompatibility of PEG, and the imaging ability of Cy5.5 near-infrared fluorescent dye, making it suitable for drug tracking and distribution visualization in vitro cell experiments and in vivo animal models. price>
R-M1-8511 Cy2-Raffinose Cy2-Raffinose is a fluorescent dye-conjugated derivative of raffinose. Cy2, also known as cyanine 2, is a green-fluorescent dye that can be used as a labeling tool in various biological applications. By conjugating Cy2 to the raffinose molecule,it can fluorescently tag raffinose and track its movement and localization in cells or tissues using fluorescence microscopy techniques. This allows for the study of raffinose transport, metabolism, and dynamics in biological systems. price>
R-M1-8517 Cy5-Lentinan Cy5-Lentinan is a fluorescent dye-labeled form of lentinan.By labeling lentinan with the fluorescent dye Cy5, researchers can track its distribution and localization in cells and tissues using fluorescence microscopy or other imaging techniques. This allows for the visualization and quantification of lentinan uptake and distribution within biological systems. price>
R-M1-8519 Cy3-Tz Cy3-Tz,Cy3-tetrazine is a compound that combines the fluorescent properties of Cy3 with the reactive properties of tetrazine, allowing for specific and efficient labeling of biomolecules via the IEDDA click chemistry reaction with TCO-functionalized molecules. price>